Review



5×neb reverse transcription buffer  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98

    Structured Review

    New England Biolabs 5×neb reverse transcription buffer
    5×Neb Reverse Transcription Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1438 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/5%C3%97+reverse-transcriptase+buffer/ProtoScript+II+Reverse+Transcriptase/us12467102-259-22-28
    Average 98 stars, based on 1438 article reviews
    5×neb reverse transcription buffer - by Bioz Stars, 2026-09
    98/100 stars

    Images

    Related Articles

    Reverse Transcription:

    Article Title: Massively parallel COVID-19 diagnostic assay for simultaneous testing of 19200 patient samples
    Article Snippet: .. RT master mix reservoir: Prepare a reservoir containing multiples of 100 μL of 10 mM dNTP mixture (NEB N0447L), 400 μL of 5×NEB Reverse Transcription Buffer (included with NEB M0368X), and 200 μL of 0.1 Molar DTT (SIGMA 43815). ..

    Article Title: Potyviruses recruit host eIF4A3 to block m 6 A-mediated RNA decay by steric hindrance of viral RNA methylation in plants
    Article Snippet: Direct RNA sequencing (DRS) libraries were prepared from poly(A)+ RNA enriched from SCMV-infected maize samples using the SQK-RNA004 kit (Oxford Nanopore Technologies, ONT). .. For adapter ligation, 9 μl poly(A)+ RNA, 3 μl NEBNext Quick Ligation Reaction Buffer (NEB, B6058), 1 μl RT Adapter (ONT, SQK-RNA004), and 2 μl T4 DNA ligase (NEB, M0202) were mixed and incubated at 25°C for 10 min. Reverse-transcription reagents were then added to the 15 μl ligation mixture: 8 μl 5 × First-Strand Buffer (NEB, M0681), 2 μl 10 mM dNTPs (NEB, N0447), 9 μl nuclease-free water, 4 μl 0.1 M dithiothreitol (DTT), and 2 μl Induro Reverse Transcriptase (NEB, M0681). ..

    Article Title: Supporting Information Site-directed RNA editing in vivo can be triggered by the light-driven assembly of an artificial riboprotein
    Article Snippet: .. Editing was stopped by adding an excess of an antisense DNA oligo (5 ́- TGACGGCTGGCTGCACCATT, final concentration 20 μM), MgCl2 (2.6 mM), dNTPs (0.27 mM each), a primer for reverse transcription (Stop66 rv, 0.5 μM), DTT (5.3 mM), and M-MuLV RT buffer (1.25 μl, NEB), and heating to 70°C for 3 min. After heating M-MuLV-reverse transcriptase (50 units, 0.5 μl NEB) was added and the reaction mixture was incubated at 42°C for 2 h. Afterwards the cDNA was purified and concentrated using the NucleoSpin gel and PCR clean-up (Machery-Nagel). ..

    Article Title: Genome-wide profiling of RNA 2’- O -methylation in neurons and identification of orphan snoRNA targets
    Article Snippet: .. To this, 8 μL of ProtoScript II buffer (5×, New England Biolabs, #B0368S), 1 μL of RNaseOUT inhibitor, 4 μL of 0.1 M DTT (New England Biolabs, #B1034A), and 2 μL of ProtoScript II Reverse Transcriptase (New England Biolabs, #M0368S) were added to bring the final reaction volume to 40 μL. ..

    Gentle:

    Article Title: Single-cell Micro-C profiles 3D genome structures at high resolution and characterizes multi-enhancer hubs
    Article Snippet: .. End digestion and repair was executed with the following two steps: first, resuspend the cell pellet in 45 μl end repair buffer 1 (1× NEBuffer 2.1, 2 mM adenosine triphosphate, 5 mM dithiothreitol, 2.5 μl 10 U μl −1 T4 polynucleotide kinase) and incubate at 37 °C for 15 min with gentle vortex to add 5′ phosphate and remove 3′ phosphoryl groups; next, add 5 μl 5 U μl −1 Klenow fragment (NEB, M0210S) and incubate at 37 °C for 15 min with gentle vortex to remove 3′ overhangs. ..

    Article Title: Single-cell Micro-C profiles 3D genome structures at high resolution and characterizes multi-enhancer hubs.
    Article Snippet: .. End digestion and repair was executed with the following two steps: first, resuspend the cell pellet in 45 μl end repair buffer 1 (1× NEBuffer 2.1, 2 mM adenosine triphosphate, 5 mM dithiothreitol, 2.5 μl 10 U μl−1 T4 polynucleotide kinase) and incubate at 37 °C for 15 min with gentle vortex to add 5′ phosphate and remove 3′ phosphoryl groups; next, add 5 μl 5 U μl−1 Klenow fragment (NEB, M0210S) and incubate at 37 °C for 15 min with gentle vortex to remove 3′ overhangs. ..

    Incubation:

    Article Title: Establishment of chromatin architecture interplays with embryo hypertranscription.
    Article Snippet: After fertilization, early embryos undergo dissolution of conventional chromatin organization, including topologically associating domains (TADs).. Zygotic genome activation then commences amid unusually slow de novo establishment of three-dimensional chromatin architecture.. How chromatin organization is established and how it interplays with transcription in early mammalian embryos remain elusive.

    Article Title: Potyviruses recruit host eIF4A3 to block m 6 A-mediated RNA decay by steric hindrance of viral RNA methylation in plants
    Article Snippet: Direct RNA sequencing (DRS) libraries were prepared from poly(A)+ RNA enriched from SCMV-infected maize samples using the SQK-RNA004 kit (Oxford Nanopore Technologies, ONT). .. For adapter ligation, 9 μl poly(A)+ RNA, 3 μl NEBNext Quick Ligation Reaction Buffer (NEB, B6058), 1 μl RT Adapter (ONT, SQK-RNA004), and 2 μl T4 DNA ligase (NEB, M0202) were mixed and incubated at 25°C for 10 min. Reverse-transcription reagents were then added to the 15 μl ligation mixture: 8 μl 5 × First-Strand Buffer (NEB, M0681), 2 μl 10 mM dNTPs (NEB, N0447), 9 μl nuclease-free water, 4 μl 0.1 M dithiothreitol (DTT), and 2 μl Induro Reverse Transcriptase (NEB, M0681). ..

    Article Title: Supporting Information Site-directed RNA editing in vivo can be triggered by the light-driven assembly of an artificial riboprotein
    Article Snippet: .. Editing was stopped by adding an excess of an antisense DNA oligo (5 ́- TGACGGCTGGCTGCACCATT, final concentration 20 μM), MgCl2 (2.6 mM), dNTPs (0.27 mM each), a primer for reverse transcription (Stop66 rv, 0.5 μM), DTT (5.3 mM), and M-MuLV RT buffer (1.25 μl, NEB), and heating to 70°C for 3 min. After heating M-MuLV-reverse transcriptase (50 units, 0.5 μl NEB) was added and the reaction mixture was incubated at 42°C for 2 h. Afterwards the cDNA was purified and concentrated using the NucleoSpin gel and PCR clean-up (Machery-Nagel). ..

    Adapter Ligation:

    Article Title: Potyviruses recruit host eIF4A3 to block m 6 A-mediated RNA decay by steric hindrance of viral RNA methylation in plants
    Article Snippet: Direct RNA sequencing (DRS) libraries were prepared from poly(A)+ RNA enriched from SCMV-infected maize samples using the SQK-RNA004 kit (Oxford Nanopore Technologies, ONT). .. For adapter ligation, 9 μl poly(A)+ RNA, 3 μl NEBNext Quick Ligation Reaction Buffer (NEB, B6058), 1 μl RT Adapter (ONT, SQK-RNA004), and 2 μl T4 DNA ligase (NEB, M0202) were mixed and incubated at 25°C for 10 min. Reverse-transcription reagents were then added to the 15 μl ligation mixture: 8 μl 5 × First-Strand Buffer (NEB, M0681), 2 μl 10 mM dNTPs (NEB, N0447), 9 μl nuclease-free water, 4 μl 0.1 M dithiothreitol (DTT), and 2 μl Induro Reverse Transcriptase (NEB, M0681). ..

    Ligation:

    Article Title: Potyviruses recruit host eIF4A3 to block m 6 A-mediated RNA decay by steric hindrance of viral RNA methylation in plants
    Article Snippet: Direct RNA sequencing (DRS) libraries were prepared from poly(A)+ RNA enriched from SCMV-infected maize samples using the SQK-RNA004 kit (Oxford Nanopore Technologies, ONT). .. For adapter ligation, 9 μl poly(A)+ RNA, 3 μl NEBNext Quick Ligation Reaction Buffer (NEB, B6058), 1 μl RT Adapter (ONT, SQK-RNA004), and 2 μl T4 DNA ligase (NEB, M0202) were mixed and incubated at 25°C for 10 min. Reverse-transcription reagents were then added to the 15 μl ligation mixture: 8 μl 5 × First-Strand Buffer (NEB, M0681), 2 μl 10 mM dNTPs (NEB, N0447), 9 μl nuclease-free water, 4 μl 0.1 M dithiothreitol (DTT), and 2 μl Induro Reverse Transcriptase (NEB, M0681). ..

    Concentration Assay:

    Article Title: Supporting Information Site-directed RNA editing in vivo can be triggered by the light-driven assembly of an artificial riboprotein
    Article Snippet: .. Editing was stopped by adding an excess of an antisense DNA oligo (5 ́- TGACGGCTGGCTGCACCATT, final concentration 20 μM), MgCl2 (2.6 mM), dNTPs (0.27 mM each), a primer for reverse transcription (Stop66 rv, 0.5 μM), DTT (5.3 mM), and M-MuLV RT buffer (1.25 μl, NEB), and heating to 70°C for 3 min. After heating M-MuLV-reverse transcriptase (50 units, 0.5 μl NEB) was added and the reaction mixture was incubated at 42°C for 2 h. Afterwards the cDNA was purified and concentrated using the NucleoSpin gel and PCR clean-up (Machery-Nagel). ..

    Purification:

    Article Title: Supporting Information Site-directed RNA editing in vivo can be triggered by the light-driven assembly of an artificial riboprotein
    Article Snippet: .. Editing was stopped by adding an excess of an antisense DNA oligo (5 ́- TGACGGCTGGCTGCACCATT, final concentration 20 μM), MgCl2 (2.6 mM), dNTPs (0.27 mM each), a primer for reverse transcription (Stop66 rv, 0.5 μM), DTT (5.3 mM), and M-MuLV RT buffer (1.25 μl, NEB), and heating to 70°C for 3 min. After heating M-MuLV-reverse transcriptase (50 units, 0.5 μl NEB) was added and the reaction mixture was incubated at 42°C for 2 h. Afterwards the cDNA was purified and concentrated using the NucleoSpin gel and PCR clean-up (Machery-Nagel). ..

    Polymerase Chain Reaction:

    Article Title: Supporting Information Site-directed RNA editing in vivo can be triggered by the light-driven assembly of an artificial riboprotein
    Article Snippet: .. Editing was stopped by adding an excess of an antisense DNA oligo (5 ́- TGACGGCTGGCTGCACCATT, final concentration 20 μM), MgCl2 (2.6 mM), dNTPs (0.27 mM each), a primer for reverse transcription (Stop66 rv, 0.5 μM), DTT (5.3 mM), and M-MuLV RT buffer (1.25 μl, NEB), and heating to 70°C for 3 min. After heating M-MuLV-reverse transcriptase (50 units, 0.5 μl NEB) was added and the reaction mixture was incubated at 42°C for 2 h. Afterwards the cDNA was purified and concentrated using the NucleoSpin gel and PCR clean-up (Machery-Nagel). ..

    Phospho-proteomics:

    Article Title: Elementary 3D organization of active and silenced E. coli genome
    Article Snippet: .. The pellet was resuspended in 95 μl 1.05× T4 DNA ligase buffer (NEB) followed by adding 5 μl PNK (10 U μl −1 , NEB) and incubating for 1 h at 37 °C with shaking at 900 rpm to ensure complete phosphorylation of DNA 5′ ends. .. The sample was pelleted as above and resuspended in 478 μl 1.02× T4 DNA ligase buffer (Thermo Fisher) followed by adding 12.5 μl T4 DNA ligase (5 Weiss U μl −1 , Thermo Fisher).



    Similar Products

    98
    New England Biolabs 5×neb reverse transcription buffer
    5×Neb Reverse Transcription Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/5%C3%97+reverse-transcriptase+buffer/ProtoScript+II+Reverse+Transcriptase/us12467102-259-22-28
    Average 98 stars, based on 1 article reviews
    5×neb reverse transcription buffer - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    90
    Yeasen Biotechnology 5 × hifair® iii reverse transcriptase buffer 15662es
    5 × Hifair® Iii Reverse Transcriptase Buffer 15662es, supplied by Yeasen Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/5%C3%97+reverse-transcriptase+buffer/primescript+reagent+kit+15662es/pmc12059478-57-8-14
    Average 90 stars, based on 1 article reviews
    5 × hifair® iii reverse transcriptase buffer 15662es - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher maxima h minus reverse transcriptase (200u/μl) with 5×rt buffer

    Maxima H Minus Reverse Transcriptase (200u/μl) With 5×Rt Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/5%C3%97+reverse-transcriptase+buffer/maxima+h+minus+reverse+transcriptase/pmc11539149-15-7-10
    Average 90 stars, based on 1 article reviews
    maxima h minus reverse transcriptase (200u/μl) with 5×rt buffer - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Promega 5 × m‐mlv reverse transcriptase buffer

    5 × M‐Mlv Reverse Transcriptase Buffer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/5%C3%97+reverse-transcriptase+buffer/mgcl2/pmc11193114-93-10-14
    Average 90 stars, based on 1 article reviews
    5 × m‐mlv reverse transcriptase buffer - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Promega reverse transcriptase 5 × reaction buffer

    Reverse Transcriptase 5 × Reaction Buffer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/5%C3%97+reverse-transcriptase+buffer/reverse+transcriptase+5+%C3%97+reaction+buffer/pmc11288740-112-39-45
    Average 90 stars, based on 1 article reviews
    reverse transcriptase 5 × reaction buffer - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Yeasen Biotechnology 5×hifair®cultra reverse transcriptase reaction buffer

    5×Hifair®Cultra Reverse Transcriptase Reaction Buffer, supplied by Yeasen Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/5%C3%97+reverse-transcriptase+buffer/5%C3%97hifair+cultra+reverse+transcriptase+reaction+buffer/ppr0762890-54-33-40
    Average 90 stars, based on 1 article reviews
    5×hifair®cultra reverse transcriptase reaction buffer - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher 8 µl of 5× maxima h minus reverse transcriptase buffer

    8 µl Of 5× Maxima H Minus Reverse Transcriptase Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/5%C3%97+reverse-transcriptase+buffer/pm37024678-308-25-40
    Average 90 stars, based on 1 article reviews
    8 µl of 5× maxima h minus reverse transcriptase buffer - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    96
    TaKaRa smartscribe 5× first strand buffer

    Smartscribe 5× First Strand Buffer, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/5%C3%97+reverse-transcriptase+buffer/SMARTScribe+Reverse+Transcriptase/pmc09901934-194-8-12
    Average 96 stars, based on 1 article reviews
    smartscribe 5× first strand buffer - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    TaKaRa smartscribe 5×first strand buffer

    Smartscribe 5×First Strand Buffer, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/5%C3%97+reverse-transcriptase+buffer/SMARTScribe+Reverse+Transcriptase/pmc08692905-40-67-70
    Average 96 stars, based on 1 article reviews
    smartscribe 5×first strand buffer - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    90
    Promega mumlv-rt reverse transcriptase 5× buffer

    Mumlv Rt Reverse Transcriptase 5× Buffer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/5%C3%97+reverse-transcriptase+buffer/reverse+transcriptase+enzyme/pmc02453129-358-53-27
    Average 90 stars, based on 1 article reviews
    mumlv-rt reverse transcriptase 5× buffer - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results


    Journal: iScience

    Article Title: Time course transcriptomic profiling suggests Crp/Fnr transcriptional regulation of nosZ gene in a N 2 O-reducing thermophile

    doi: 10.1016/j.isci.2024.111074

    Figure Lengend Snippet:

    Article Snippet: Maxima H Minus Reverse Transcriptase (200U/μL) with 5×RT Buffer , ThermoFisher , Cat# EP0751.

    Techniques: Virus, Recombinant, Reverse Transcription, Isolation, Control, Sequencing, Mass Spectrometry, Software, In Silico, Targeted Proteomics