5×neb reverse transcription buffer (New England Biolabs)
98
Structured Review
New England Biolabs
5×neb reverse transcription buffer
5×Neb Reverse Transcription Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1438 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/5%C3%97+reverse-transcriptase+buffer/ProtoScript+II+Reverse+Transcriptase/us12467102-259-22-28
Average 98 stars, based on 1438 article reviews
5×Neb Reverse Transcription Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1438 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/5%C3%97+reverse-transcriptase+buffer/ProtoScript+II+Reverse+Transcriptase/us12467102-259-22-28
Average 98 stars, based on 1438 article reviews
5×neb reverse transcription buffer - by Bioz Stars,
2026-09
98/100 stars
Images
Related Articles
Reverse Transcription:Article Title: Massively parallel COVID-19 diagnostic assay for simultaneous testing of 19200 patient samples Article Snippet: .. RT master mix reservoir: Prepare a reservoir containing multiples of 100 μL of 10 mM dNTP mixture (NEB N0447L), 400 μL of Article Title: Potyviruses recruit host eIF4A3 to block m 6 A-mediated RNA decay by steric hindrance of viral RNA methylation in plants Article Snippet: Direct RNA sequencing (DRS) libraries were prepared from poly(A)+ RNA enriched from SCMV-infected maize samples using the SQK-RNA004 kit (Oxford Nanopore Technologies, ONT). .. For adapter ligation, 9 μl poly(A)+ RNA, 3 μl NEBNext Quick Ligation Reaction Buffer (NEB, B6058), 1 μl RT Adapter (ONT, SQK-RNA004), and 2 μl T4 DNA ligase (NEB, M0202) were mixed and incubated at 25°C for 10 min. Reverse-transcription reagents were then added to the 15 μl ligation mixture: 8 μl 5 × Article Title: Supporting Information Site-directed RNA editing in vivo can be triggered by the light-driven assembly of an artificial riboprotein Article Snippet: .. Editing was stopped by adding an excess of an antisense DNA oligo (5 ́- TGACGGCTGGCTGCACCATT, final concentration 20 μM), MgCl2 (2.6 mM), dNTPs (0.27 mM each), a primer for reverse transcription (Stop66 rv, 0.5 μM), DTT (5.3 mM), and M-MuLV RT buffer (1.25 μl, NEB), and heating to 70°C for 3 min. After heating Article Title: Genome-wide profiling of RNA 2’- O -methylation in neurons and identification of orphan snoRNA targets Article Snippet: .. To this, 8 μL of Gentle:Article Title: Single-cell Micro-C profiles 3D genome structures at high resolution and characterizes multi-enhancer hubs Article Snippet: .. End digestion and repair was executed with the following two steps: first, resuspend the cell pellet in 45 μl Article Title: Single-cell Micro-C profiles 3D genome structures at high resolution and characterizes multi-enhancer hubs. Article Snippet: .. End digestion and repair was executed with the following two steps: first, resuspend the cell pellet in 45 μl Incubation:Article Title: Establishment of chromatin architecture interplays with embryo hypertranscription. Article Snippet: After fertilization, early embryos undergo dissolution of conventional chromatin organization, including topologically associating domains (TADs).. Zygotic genome activation then commences amid unusually slow de novo establishment of three-dimensional chromatin architecture.. How chromatin organization is established and how it interplays with transcription in early mammalian embryos remain elusive. Article Title: Potyviruses recruit host eIF4A3 to block m 6 A-mediated RNA decay by steric hindrance of viral RNA methylation in plants Article Snippet: Direct RNA sequencing (DRS) libraries were prepared from poly(A)+ RNA enriched from SCMV-infected maize samples using the SQK-RNA004 kit (Oxford Nanopore Technologies, ONT). .. For adapter ligation, 9 μl poly(A)+ RNA, 3 μl NEBNext Quick Ligation Reaction Buffer (NEB, B6058), 1 μl RT Adapter (ONT, SQK-RNA004), and 2 μl T4 DNA ligase (NEB, M0202) were mixed and incubated at 25°C for 10 min. Reverse-transcription reagents were then added to the 15 μl ligation mixture: 8 μl 5 × Article Title: Supporting Information Site-directed RNA editing in vivo can be triggered by the light-driven assembly of an artificial riboprotein Article Snippet: .. Editing was stopped by adding an excess of an antisense DNA oligo (5 ́- TGACGGCTGGCTGCACCATT, final concentration 20 μM), MgCl2 (2.6 mM), dNTPs (0.27 mM each), a primer for reverse transcription (Stop66 rv, 0.5 μM), DTT (5.3 mM), and M-MuLV RT buffer (1.25 μl, NEB), and heating to 70°C for 3 min. After heating Adapter Ligation:Article Title: Potyviruses recruit host eIF4A3 to block m 6 A-mediated RNA decay by steric hindrance of viral RNA methylation in plants Article Snippet: Direct RNA sequencing (DRS) libraries were prepared from poly(A)+ RNA enriched from SCMV-infected maize samples using the SQK-RNA004 kit (Oxford Nanopore Technologies, ONT). .. For adapter ligation, 9 μl poly(A)+ RNA, 3 μl NEBNext Quick Ligation Reaction Buffer (NEB, B6058), 1 μl RT Adapter (ONT, SQK-RNA004), and 2 μl T4 DNA ligase (NEB, M0202) were mixed and incubated at 25°C for 10 min. Reverse-transcription reagents were then added to the 15 μl ligation mixture: 8 μl 5 × Ligation:Article Title: Potyviruses recruit host eIF4A3 to block m 6 A-mediated RNA decay by steric hindrance of viral RNA methylation in plants Article Snippet: Direct RNA sequencing (DRS) libraries were prepared from poly(A)+ RNA enriched from SCMV-infected maize samples using the SQK-RNA004 kit (Oxford Nanopore Technologies, ONT). .. For adapter ligation, 9 μl poly(A)+ RNA, 3 μl NEBNext Quick Ligation Reaction Buffer (NEB, B6058), 1 μl RT Adapter (ONT, SQK-RNA004), and 2 μl T4 DNA ligase (NEB, M0202) were mixed and incubated at 25°C for 10 min. Reverse-transcription reagents were then added to the 15 μl ligation mixture: 8 μl 5 × Concentration Assay:Article Title: Supporting Information Site-directed RNA editing in vivo can be triggered by the light-driven assembly of an artificial riboprotein Article Snippet: .. Editing was stopped by adding an excess of an antisense DNA oligo (5 ́- TGACGGCTGGCTGCACCATT, final concentration 20 μM), MgCl2 (2.6 mM), dNTPs (0.27 mM each), a primer for reverse transcription (Stop66 rv, 0.5 μM), DTT (5.3 mM), and M-MuLV RT buffer (1.25 μl, NEB), and heating to 70°C for 3 min. After heating Purification:Article Title: Supporting Information Site-directed RNA editing in vivo can be triggered by the light-driven assembly of an artificial riboprotein Article Snippet: .. Editing was stopped by adding an excess of an antisense DNA oligo (5 ́- TGACGGCTGGCTGCACCATT, final concentration 20 μM), MgCl2 (2.6 mM), dNTPs (0.27 mM each), a primer for reverse transcription (Stop66 rv, 0.5 μM), DTT (5.3 mM), and M-MuLV RT buffer (1.25 μl, NEB), and heating to 70°C for 3 min. After heating Polymerase Chain Reaction:Article Title: Supporting Information Site-directed RNA editing in vivo can be triggered by the light-driven assembly of an artificial riboprotein Article Snippet: .. Editing was stopped by adding an excess of an antisense DNA oligo (5 ́- TGACGGCTGGCTGCACCATT, final concentration 20 μM), MgCl2 (2.6 mM), dNTPs (0.27 mM each), a primer for reverse transcription (Stop66 rv, 0.5 μM), DTT (5.3 mM), and M-MuLV RT buffer (1.25 μl, NEB), and heating to 70°C for 3 min. After heating Phospho-proteomics:Article Title: Elementary 3D organization of active and silenced E. coli genome Article Snippet: .. The pellet was resuspended in 95 μl 1.05× T4 DNA ligase buffer (NEB) followed by adding 5 μl |
