5×neb reverse transcription buffer (New England Biolabs)

New England Biolabs is a verified supplier

New England Biolabs manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

New England Biolabs 5×neb reverse transcription buffer
5×Neb Reverse Transcription Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1460 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/5%C3%97+reverse-transcriptase+buffer/ProtoScript+II+Reverse+Transcriptase/us12467102-259-22-28
Average 98 stars, based on 1460 article reviews

5×neb reverse transcription buffer - by Bioz Stars, 2026-10

98/100 stars

Images

Reverse Transcription:

Article Title: Massively parallel COVID-19 diagnostic assay for simultaneous testing of 19200 patient samples
Article Snippet: .. RT master mix reservoir: Prepare a reservoir containing multiples of 100 μL of 10 mM dNTP mixture (NEB N0447L), 400 μL of 5×NEB Reverse Transcription Buffer (included with NEB M0368X), and 200 μL of 0.1 Molar DTT (SIGMA 43815). ..

Article Title: Potyviruses recruit host eIF4A3 to block m 6 A-mediated RNA decay by steric hindrance of viral RNA methylation in plants
Article Snippet: Direct RNA sequencing (DRS) libraries were prepared from poly(A)+ RNA enriched from SCMV-infected maize samples using the SQK-RNA004 kit (Oxford Nanopore Technologies, ONT). .. For adapter ligation, 9 μl poly(A)+ RNA, 3 μl NEBNext Quick Ligation Reaction Buffer (NEB, B6058), 1 μl RT Adapter (ONT, SQK-RNA004), and 2 μl T4 DNA ligase (NEB, M0202) were mixed and incubated at 25°C for 10 min. Reverse-transcription reagents were then added to the 15 μl ligation mixture: 8 μl 5 × First-Strand Buffer (NEB, M0681), 2 μl 10 mM dNTPs (NEB, N0447), 9 μl nuclease-free water, 4 μl 0.1 M dithiothreitol (DTT), and 2 μl Induro Reverse Transcriptase (NEB, M0681). ..

Article Title: Supporting Information Site-directed RNA editing in vivo can be triggered by the light-driven assembly of an artificial riboprotein
Article Snippet: .. Editing was stopped by adding an excess of an antisense DNA oligo (5 ́- TGACGGCTGGCTGCACCATT, final concentration 20 μM), MgCl2 (2.6 mM), dNTPs (0.27 mM each), a primer for reverse transcription (Stop66 rv, 0.5 μM), DTT (5.3 mM), and M-MuLV RT buffer (1.25 μl, NEB), and heating to 70°C for 3 min. After heating M-MuLV-reverse transcriptase (50 units, 0.5 μl NEB) was added and the reaction mixture was incubated at 42°C for 2 h. Afterwards the cDNA was purified and concentrated using the NucleoSpin gel and PCR clean-up (Machery-Nagel). .. Editing was stopped by adding an excess of an antisense DNA oligo (5 ́- TGACGGCTGGCTGCACCATT, final concentration 20 μM), MgCl2 (2.6 mM), dNTPs (0.27 mM each), a primer for reverse transcription (Stop66 rv, 0.5 μM), DTT (5.3 mM), and M-MuLV RT buffer (1.25 μl, NEB), and heating to 70°C for 3 min. After heating M-MuLV-reverse transcriptase (50 units, 0.5 μl NEB) was added and the reaction mixture was incubated at 42°C for 2 h. Afterwards the cDNA was purified and concentrated using the NucleoSpin gel and PCR clean-up (Machery-Nagel).

Article Title: Genome-wide profiling of RNA 2’- O -methylation in neurons and identification of orphan snoRNA targets
Article Snippet: .. To this, 8 μL of ProtoScript II buffer (5×, New England Biolabs, #B0368S), 1 μL of RNaseOUT inhibitor, 4 μL of 0.1 M DTT (New England Biolabs, #B1034A), and 2 μL of ProtoScript II Reverse Transcriptase (New England Biolabs, #M0368S) were added to bring the final reaction volume to 40 μL. ..

Article Title: Cotranslational membrane protein biogenesis by an EMC-bound translocon.
Article Snippet: After adding Nature Structural & Molecular Biology Article https://doi.org/10.1038/s41594-026-01889-2 100 μl of chloroform (Sigma-Aldrich, cat. no. C2432), RNA in the aqueous layer was separated by centrifugation at 12,000g for 15 min at 4 °C and precipitated overnight by adding 0.1 volume of 3 M sodium acetate (Invitrogen, cat. no. AM9740), 20 μg of GlycoBlue (Invitrogen, cat. no. AM9515) and 1.2 volumes of isopropanol. .. Purified RNase footprints used for DNA library preparation were resuspended in 5 μl of T4 polynucleotide kinase (PNK) reaction mixture (1× PNK buffer, 10 U of PNK (NEB, cat. no. M0201L) and 10 U of SUPERaseIn (Invitrogen, cat. no. AM2694)) and end-repaired at 37 °C for 1 h. Next, 5 μl of polyadenylation mix containing 10 U of Escherichia coli poly (A) polymerase (NEB, cat. no. M0276L), 2 μl of 5× first-strand buffer (250 mM Tris-HCl pH 8.3, 375 mM KCl, 15 mM MgCl2), 0.25 mM ATP and 10 U SUPERaseIn was added, and the reaction was incubated at 37 °C for 2 h. The resulting polyadenylated RNAs were reverse transcribed by SMART-RT, by adding 2.5 μl of reverse transcription primer (10 μM, 5′-ACGTGTGCTCTTCCGATCTNNNNNN NNNNNNNNNTTTTTTTTTTTTTTTVN-3′, where ‘N’ is any base and ‘V’ is ‘A’, ‘C’ or ‘G’), annealing by heating to 72 °C for 5 min and cooling on ice, and then supplementing with 17.6 μl of SMART-RT mixture (2.5 μl of dNTP (10 mM), 400 U of Superscript II reverse transcriptase (Invitrogen, cat. no. 18064014), 10 U of SUPERaseIn, 4 μl of Superscript II first-strand buffer (5×), 1.5 μl of DTT (100 mM), 6 μl of Betaine (5 M), 0.12 μl of MgCl2 (1 M), 0.5 μl of template-switching oligos (100 μM 5′-CTCTTTCCCTACACGACGCTCTTCCGATCTNNNNrGrG+G-3′, where ‘N’ is any base and ‘+G’ is a locked nucleic acid guanylate) and 0.5 μl of nuclease-free water). ..

Gentle:

Article Title: Single-cell Micro-C profiles 3D genome structures at high resolution and characterizes multi-enhancer hubs
Article Snippet: .. End digestion and repair was executed with the following two steps: first, resuspend the cell pellet in 45 μl end repair buffer 1 (1× NEBuffer 2.1, 2 mM adenosine triphosphate, 5 mM dithiothreitol, 2.5 μl 10 U μl −1 T4 polynucleotide kinase) and incubate at 37 °C for 15 min with gentle vortex to add 5′ phosphate and remove 3′ phosphoryl groups; next, add 5 μl 5 U μl −1 Klenow fragment (NEB, M0210S) and incubate at 37 °C for 15 min with gentle vortex to remove 3′ overhangs. ..

Incubation:

Article Title: Establishment of chromatin architecture interplays with embryo hypertranscription.
Article Snippet: After fertilization, early embryos undergo dissolution of conventional chromatin organization, including topologically associating domains (TADs).. Zygotic genome activation then commences amid unusually slow de novo establishment of three-dimensional chromatin architecture.. How chromatin organization is established and how it interplays with transcription in early mammalian embryos remain elusive.

Adapter Ligation:

Ligation:

Concentration Assay:

Purification:

Polymerase Chain Reaction:

Phospho-proteomics:

Article Title: Elementary 3D organization of active and silenced E. coli genome
Article Snippet: .. The pellet was resuspended in 95 μl 1.05× T4 DNA ligase buffer (NEB) followed by adding 5 μl PNK (10 U μl −1 , NEB) and incubating for 1 h at 37 °C with shaking at 900 rpm to ensure complete phosphorylation of DNA 5′ ends. .. The sample was pelleted as above and resuspended in 478 μl 1.02× T4 DNA ligase buffer (Thermo Fisher) followed by adding 12.5 μl T4 DNA ligase (5 Weiss U μl −1 , Thermo Fisher).

Review